Improving furfural tolerance of recombinant E. coli in the fermentation of lignocellulosic sugars into ethanol

1. INTRODUCTION

Lignoccllulose is an abundant renewable resource that can be converted into fuels and chemicals by bioeatalysts. In contrast to starch, sugarcane, and sugar beet, the use of lignocellulosic residues and short rotation trees would not directly compete with food production (Liu ct al. 2019, Zukowska et al. 2016). Unlike starch, lignoccllulose has been designed by nature to resist deconstruction. Crystalline fibers of cellulose arc encased in a covalently linked mesh of lignin and hemicellulose. Dilute acid pretreatment of lignoccllulose has been widely investigated to increase enzyme access to cellulose and hydrolyze hemicelluloscs (Liu & Bao 2019, Pimentel 2012, Dowbor 2013). During this acid pretreatment, small amounts of side products including furans, carboxylic acids, and aromatic compounds are produced that retard microbial fermentation.

Expression of fucO from plasmids has been used to improve furfural tolerance in Escherichia coli-based fermentations for ethanol and lactic acid (Wang et al. 2011). The reduction of furfural to the less toxic alcohol seems essential for growth and fermentation of dilute acid hydrolysates of hemicelluloscs (Wang ct al. 2019). In this study, we have used site-specific mutagenesis and growth-based selection to identify a fucO mutation that confers a further increase in furfural tolerance.

2 RESEARCH MATERIALS AND METHODS

The strains, plasmids, and primers used in this study are described as listed in Table 1. LB medium containing xylose was used for the construction of ethanol strains. AMI minimal salts medium with xylose was used for the maintenance and growth of cthanologenic strains. Solid medium contained 20 g/L xylose. Broth cultures contained 50 g/L xylose. Batch fermentations contained 100 g/L xylose. Cultures were incubated at 37°C unless stated otherwise. Plates streaked with cthanologenic strains were incubated under argon.

Standard genetic methods were used for the isolation of DNA and plasmids, digestion with restriction enzymes, PCR amplification of DNA, and plasmid constructions. Enzymes were purchased from New England BioLabs (Ipswich, MA) and used as directed by the vendor. Plasmid constructions were confirmed by Sanger sequencing.

3 RESULTS

Furfural has been shown to cause DNA damage in Escherichia coli and to inhibit growth until furfural has been substantially metabolized to the less toxic alcohol. Strategies have been developed to reduce the toxicity of dilute acid hydrolysates. A chromosomal library of Bacillus subtilis YB886 was screened to identify thyA that increased the furfural tolerance of E. coli LY180 (Zheng et al. 2012). The enzyme L-l, 2-propanediol oxidorcductase (encoded by fucO) is an NADH-linkcd, iron-dependent group III dehydrogenase.

Strains, plasmids or primers

Relevant characleristicsa

Reference

Strains

TOPIOF'

F’[laclq TnlO(tetR)] mcrA A(mrr-hsdRMS-mcrBC) X-

Invitrogen

XW92

LYlBOa

LY180(AyqhD)

Д frd В G:: (Zm frgcel Y Ec), ldhA::(ZmfrgcasABKo), adhE::(ZmfrgestZPpFRT), AackA::FRT, rrlE::(pdcadhAadhBFRT),AmgsA::FRT

This study

Plasmids

pCR2.1-TOPO

pTrc99A

pLOI5536

Plac, bla, kan Ptrc, bla, laclq, fucOL8F in pTrc99a

(Invitrogen) (Pharmacia) This study

Primers

F-L8F-fuco

R-L8F-fuco

fuco-RT-F

fuco-RT-R

GCTAACAGAATGATTTTTAACGAAACGGCATGGTTTGGT ACCAA ACCATGCCGTTT CGTT AAAA ATCATTCTGTT AGC ACGCCGTGGTTATCAGAAGG CAGGT AATCCGCGCCGCTAT

This study This study This study This study

This enzyme has a broad substrate range that includes furfural. Expression of fucO from plasmids has been used to improve furfural tolerance in Escherichia coli-bascd fermentations for ethanol and lactic acid. Wc have used site-specific mutagenesis and growth-based selection to identify a fucO mutation L7F that shows an increased specific activity by 10-fold than wild-type fucO (Figure 1A). This increase in specific activity was confirmed from SDS-PAGE (12.5% acrylamide) (Figure IB). One band of soluble mutated sample in the fucO region (38.2 kDa) was observed more dense than that of wild type fucO.

Specific activity of wild type fucO and its mutant fucOLSF

Figure 1. Specific activity of wild type fucO and its mutant fucOLSF (A), pTrc99a is empty vector in which fucO is cloned. SDS-PAGE of crude extract from strains XW92 and pTrc99a (lane 1), pTrc99a derivatives containing fucO genes (lane 2), pTrc99a derivatives containing fucOL8F gene (lane 3) (B). The arrow indicates the putative FucO protein from plasmid expression. M. molecular mass marker lanes.

Increased expression of fucO increased the furfural degradation rate in fermentation

Figure 2. Increased expression of fucO increased the furfural degradation rate in fermentation. (A) Cell mass of fermentation on 15 mM furfural. (B) Furfural degradation of strains during fermentation with 15 mM furfural. (C) Ethanol production of strains during fermentation with 15 mM furfural.

The L7F FucO mutation also improved the fermentation performance (strain XW92) in AMI medium with 100 g/L xylose and 15mM furfural (Figure 2). With the mutant gene (pLOI5536), 15mM furfural was completely metabolized in 12 h, compared to 24 h with the native fucO gene (pLOI4319) and 48 h with the empty vector. With all two strains, growth and ethanol production were delayed until furfural had been substantially metabolized to the corresponding alcohol. In the presence of 15 mM furfural in broth, both wild-type strain and fucO mutant strain reached the same ethanol titer at 72 h as XW92(pTrc99a) did without furfural.

4 DISCUSSION AND CONCLUSIONS

Many methods are available to create sequence diversity libraries, including chemical mutagenesis, error-prone PCR. saturation mutagenesis, and DNA shuffling. With the mutant gene, furfural was metabolized in vivo at twice the rate of the native enzyme during fermentation (Wang et al. 2011). In this study, we have used site-specific mutagenesis and growth-based selection to identify a fucO mutation that confers a further increase in furfural tolerance. The fucO(L7F) mutant exhibited a 10-fold increase in cytoplasmic activity and was isolated after the screening of only 1,400 colonies. The site of this mutation was unexpected, with the contact region of homodimers distant from the active site. With the mutant gene, furfural was metabolized in vivo at twice the rate of the native enzyme during fermentation.

Future research will be focused on further increasing known enzymes on catalytic activity or exploring new enzymes that were able to degrade furfural. Furthermore, systematic process optimization including strain engineering, biomass pretreatment and fermentation will be carried out to increase the titer of ethanol production in presence of furfural (Liu & Bao 2017, Liu et al. 2018).

ACKNOWLEDGEMENT

This study was supported by the National Key Research and Development Program (2018YFD0500206); and the Research and Development Fund of Zhejiang A&F University (2034020081).

REFERENCES

Dovvbor. L., 2013. Economic Democracy - Meeting Some Managmenel Challenges: Changing Scenarios in Brazil. Problems of Sustainable Development! Problem}’ Ekorozwoju, 8(2): 17-25.

Liu, C.G., Xiao, Y., Xia, X.X. et al. 2019. Cellulosic ethanol production: Progress, challenges and strategies for solutions. J. Biotechnol. Adr. 37(3):491-504.

Liu, G., Bao, J. 2019. Constructing super large scale cellulosic ethanol plant by decentralizing dry acid pretreatment technology into biomass collection depots. J. Bioresour. Technol. 275:338-344.

Pimentel, D. 2012. Energy Production from Maize. Problems of Sustainable Development!Problem)' Ekor- ozwoju, 7(2): 15-22.

Wang, X., Miller, E.N., Yomano, L.P. et al. 2011. Increased furfural tolerance due to overexpression of NADH-dependenl oxidoreductase FucO in Escherichia coli strains engineered for the production of ethanol and lactate../. Appl. Environ. Microbiol. 77( 15):5132—5140.

Wang, L.. York, S.W., Ingram, L.O. et al. 2019. Simultaneous fermentation of biomass-derived sugars to ethanol by a co-culture of an engineered Escherichia coli and Saccharomyces cerevisiae. J. Bioresour. Technol. 213:269-276.

Zukowska, G. et al. 2016. Agriculture vs. Alleviating the Climate Change. Problems of Sustainable Development! Problemy Ekorozwoju 11 (2):67—74.

 
Source
< Prev   CONTENTS   Source   Next >