A Positive Correlation Between IgG2 Antibody Preponderance and Clearance of HSV During Active HSV Infections

K. VASANTHI,1 G. SATHYA NARAYANAN,1 PUGALENDHI,2 and ELANCHEZHIYAN MANICKAN1

department of Microbiology, Dr. AIM PGIBMS,

University of Madras, Taramani, Chennai, Tamil Nadu, India

Voluntary Health Science, Taramani, Chennai, Tamil Nadu, India

ABSTRACT

Heipes simplex vims (HSV) is a human pathogenic vims that causes infection worldwide. We have studied the levels of total immunoglobulins and HSV specific immunoglobulins then the results were correlated with the latency. In this study, we enrolled 323 subjects, and blood was collected from 183 HSV active infections (94 were HSV-1 positive and 89 were HSV-2 positive), recently healed (58 HSV-1 and 48 HSV-2) and 140 age and sex controlled negative individuals. HSV positivity of the collected samples was confirmed by PCR. Total IgG and HSV specific IgG were tested by ELISA. The mean total serum IgG of HSV-1 cases was 554 pg/ml and HSV-2 cases was 696 pg/ml. Interestingly during active infection, there was a preponderance of IgG 1 (mean 185 pg/ml for HSV-1 and 195 pg/ml for HSV-2) compared to IgG2 (mean 35 pg/ml of HSV-1 and 28 pg/ml of HSV-2). However, among the recently healed individuals, the total IgG remains similar but there was an up-regulation of IgG2 that was noticed in the ranges of 185 pg/ml HSV-1 and 205 pg/ml HSV-2. Interestingly the IgGl was the vice versa (30 pg/ml for HSV-1 and 32 pg/ml for HSV-2) importantly, healthy controls had negligible anti-HSV antibodies. From this study, we could confirm that presence of IgGl antibodies is non-protective against HSV infections as seen among the non-healers. However, the presence of IgG2 is protective as noticed among the recent healers, it is long known that Tli-1 cytokine is associated with IgG2 antibody production and Th-2 cytokines promote IgGl. Taken together it becomes much clearer that during HSV infections Th-1 cells are protective and Th-2 cells are detrimental to the host.

INTRODUCTION

HSV infections are ubiquitous and cause significant morbidity worldwide with the capacity to hide in our neurons for life (latent infection). Infections with HSV-1 and HSV-2 are highly prevalent and it is estimated that more than

3.7 billion people under the age of 50 to 67% of the population are infected with herpes simplex vims (HSV) both type 1 and 2 (HSV-1, HSV-2). The WHO annually estimating over 500 million people are infected with HSV-2 worldwide with approximately 20 million cases. Also, the global rates of either HSV-1 or HSV-2 are between 60% and (5% in adults. In India, the seroposi- tivity has been reported to be 33.3% for HSV-1 and 16.6% for HSV-2 [3]. HSV establishing the lifelong persistence of its infection in the human host by its successful hiding into the neurons of peripheral ganglia and while reactivating it was liberated out from those neurons and cause recurrent infection [7].

Primary infection occurs at the early days of childhood. Once the vims infects the epithelial cells it finds its way to innervating neurons and migrates centripetally towards the CNS and reaches dorsal root ganglion. In the dorsal root ganglion, it remains almost inert (latent infection) and subsequently reactivated due to some undefined stimulus and reaches the same neurodermatome and causes chronic recurrent infections. Those undefined, nonspecific stimulus are stress, catamenia (menstrual cycle), fever, exposure to sunlight, and trauma [9].

During HSV infection the level of the immunoglobulins (IgGs) were increased up to four times than the normal level. These antibodies were serving as markers for the detection of HSV infection. Antibodies for the HSV infection usually appear in 4-7 days after the infection and extend its peak in 2-4 weeks. IgM antibodies were subjected to appear transiently and are followed by IgG and IgA antibodies during the primary infection. These antibodies were memorized lifelong in the host with the minor fluctuations. High levels of antibodies were produced when the primary infection are more sever or more recurrence infection. Although the levels of the IgGs were increased during the HSV infection but the role and status of HSV infection during the recurrent condition was remain unclear. Each IgGs increase or decrease were directly correlating cell-mediated immune response; therefore, it is significant to examine the IgGs levels during infectious status and in normal status. For example, decreasing of IgGl was associated with recurrent infections. The depression in IgG levels might contribute to the reactivation of HSV in subjects with recurrent infection. The study of IgG and their subclasses’ role during the viral infection was most important to understand the pathogenesis of the virus. Thus the present study is earned to find out the levels of total and HSV specific IgGs (IgM, IgG, and their subclasses) in seium during the active and recent herpes infection comparing with healthy subjects.

MATERIALS AND METHODS

14.2.1 STUDY POPULATION

In this study, we enrolled 429 individuals of which 183 were HSV active infection (94 were HSV-1 positive and 89 were HSV-2 positive), 106 were recently healed subjects (58 HSV-1 and 48 HSV-2) and 140 were HSV negative (Figure 14.1). Serum was obtained from serum was obtained from the above said subjects. Clinical diagnosis of HSV Positive patients was made by the department of skin and venereal diseases, Voluntary Health Services, Chennai. Age-wise classifications and gender-wise classification were done in each of the three groups. Human ethical clearance was obtained from the Institutional Human Ethical Committee (UM/IHEC/02-2017-I). A proforma was made and informed consent from each participant was obtained. The ages of the study population ranged from 1-80 years (mean, 41 years).

14.2.2 BLOOD COLLECTION

Whole blood was collected from the outpatients (Voluntary Health Services, Chennai) who had lesions on the genital area and around the mouth and from healthy individuals. Then the samples were transported to the institution using an appropriate sample container box.

  • 14.2.3 DNA EXTRACTION
  • 1. Isolation of DNA from Blood Samples: Viral DNA was extracted from blood using the NucleoSpin Blood Mini kit (LOT No. 1607/001) according to manufacture instructions and stored at -20°C for further processing.
  • 2. Quantification of DNA: Quantity and quality of the DNA was detected using NanoDrop UV spectrophotometer (Thermo Scientific, USA) at 260 and 280 A.
Study population

FIGURE 14.1 Study population.

14.2.4 PCR AMPLIFICATION FOR CONFIRMATION OF HSV

PCR was performed in targeting Glycoprotein D gene of HSV-1 and 2 for blood samples using primers described by Kessler et al. (2000). Briefly, PCR was done using a 50 pi master mix containing 5 pi of template DNA, 1 mM of each primer (Table 14.1), 1 pi of dNTPs, 2 units of Taq polymerase enzyme and 5 pi of 10X reaction buffer. PCR conditions included an initial denaturation at 95°C for 1 min followed by 35 cycles at 95°C for 30 sec (3 min during cycle 1), 55°C for 30 sec and 72°C for 30 sec and a final extension of 72°C for 5 mins and cooled down to 4°C. Nested amplification was done with a 5 pi aliquot from the first run; 50 pi of Taq PCR master mix solution; 36 pi of double-distilled, DNase-free water; and a 1 mM concentration of each nested primer by the same cycle protocol as described above. Each amplification run contained one negative and one positive control. The negative control consisted of blank reagent and water. For the positive control, total cellular nucleic acid was extracted from vims stocks which were grown in the vero cell line.

TABLE 14.1 Details of Primers Used in the Study

Primer (Initial PCR)

Sequence (S' to 3')

Expected Amplicon Size

HSV RIF HSVR1R

5 ’TGCTCCTAC AAC AAGGTC3 ’ 5 ’CGGTGCTCCAGGATATAA3 ’

200 bp

Primer (Nested PCR)

Sequence (5' to 3')

Expected Amplicon Size

HSVR2F

HSVR2R

  • 5 ’ ATCCGAACGC AGCCCCGGCTG3 ’
  • 5 ’TCTCCGTCCAGTCGTTTATCTTTC3 ’

142 bp

14.2.5 PCR AMPLICONS GEL VISUALIZATION

The PCR amplicons were resolved in 2% agarose with ethidium bromide (10 mg/ml) by electrophoresis for ~20 min at 100 V and gel was analyzed using the Carestream Gel documentation system (Figure 14.2).

14.2.6 SERUM ISOLATION

A clot from the whole blood has been removed by centrifuging at 1500 g for 10 min in a refrigerated centrifuge. The resulting supernatant was designated serum. Following centrifugation, the liquid component (serum) has been immediately transferred into a clean polypropylene (PP) tube using a Pasteur pipette. The samples were maintained at 2-8°C while handling and immediately analyzed, avoiding freeze-thaw cycles because this is detrimental to many serum components.

14.2.7 DETERMINATION OF ANTIBODIES LEVELS

The HSV confirmed (PCR positive) samples were classified as age-wise and gender-wise. Similar steps were done for healthy individuals to confirm HSV negativity. For the detection of total IgGs, levels (IgM, IgG) from the above serum samples EIA kits were obtained from ABCAM (Cat. No. abl37982-IgM, abl95215-IgG). For the detection of HSV, specific IgGs levels (IgM, IgG) from the above serum samples EIA kits were procured from CALBIOTECH, USA, and MYBIOSOURCE (USA) (Cat. No. H1M4908, H2M4989, H1G5010, H2G4881). For the detection of IgG subclasses from the above demography, the EIA kits were obtained from

Invitrogen-ThermoScientific (Cat. No. 991000). The analysis of immunoglobulins levels on serum samples was performed according to the manufactures instructions. Then the plates were read at 450 mn in an ELISA plate reader. A standard curve was plotted by linear regression analysis using the values of the standard and the values of the unknown samples were calculated from the graph.

14.2.8 DATA ANALYSIS

Obtained data were analyzed for statistical significance by Student’s-t test.

The HSV positivity of the clinical samples by PCR (in which 200 bp are the first-round PCR product and 142 bp is the second round PCR product)

FIGURE 14.2 The HSV positivity of the clinical samples by PCR (in which 200 bp are the first-round PCR product and 142 bp is the second round PCR product).

 
Source
< Prev   CONTENTS   Source   Next >